Ever wonder where you came from? If your mom isn’t around to give you
the answer, we’ve got it right here.
The folks at the UA’s Human Origins Genotyping Laboratory are in the
process of mapping where in the world we all came from. The
short answer comes in the form of a genetic family tree of hundreds of
thousands of people already in the lab’s database. The long answer is
ACAAGATGCCATTGTCCCCCGGC … (You get the idea.)
You can see DNA robots in action in this week’s featured video.
These robots may not seem as cool as the ones in Star Wars, but
they are capable of processing the DNA of all the people you have ever
known, or will ever know, within a few hours.
A cheek swab is all it takes to have your DNA entered into their
system. (But, please, don’t send in an envelope with a Q-tip inside.
They have a special kit for that.)
In addition to tracing human-migration patterns, the lab has been
using their technology to help with the DNA Shoah Project, which aims
to reconnect families victimized by the Holocaust.
As with DNA, you’ll need plenty of context to understand what’s
going on in our next video.
If you live in the northwest area of town, or if you’re a glutton
for news, you’ve probably heard of the Saguaro Ranch development.
The 1,035-acre luxury project in the Tortolita Mountains went into
bankruptcy in February, all the while drawing complaints from some
people living nearby.
Area resident Tracy Chamberlain recently filmed Marana Town Manager
Gilbert Davidson arriving at McClintock’s with his wife. Neighbors
claim the reservations-only restaurant in Saguaro Ranch was partially
built on a public easement. And it happens that the Davidsons’ evening
at the restaurant occurred two days after the arrest of Saguaro Ranch
neighbor Steve Blomquist at McClintock’s. What happens in that video?
Watch to find out.
As reported on The Range, our breaking-news blog, things have gotten
to the point where Saguaro Ranch neighbors have filed a federal lawsuit against the town of Marana and several of its leaders.
As we all know, once matters get to federal court, they get harder
to untangle than the human genome.
BEST OF WWW
One of the great things about the Internet is you can easily see
details that weren’t included in a news story, for whatever reason.
This week at TucsonWeekly.com,
you’ll find these extra details on Leo W. Banks’ story about the
various border studies that were apparently covered up: We’ve got the
studies themselves available for download.
COMMENT OF THE WEEK
“This review is uninformed. … I find that you are criticizing the
actors/actresses for following the character roles that they were hired
to play. On top of that, you are telling us your opinion of which actor
is the hottest? Please give us a review on cinematography and how well
the movie follows the book. Please do your research next time.”
—Melissa Benton, via Facebook, in reaction to Bob Grimm’s
review of The Twilight Saga: New Moon (“Abs vs. Eyebrows,” Nov.
26).
THE WEEK ON THE RANGE
Mari Herreras filled us in on the latest news in the battle between
neighbors of the exclusive Saguaro Ranch development and the town of
Marana, which included the arrest of one of the neighbors as he drank a
beer at McClintock’s, the reservation-only restaurant which sits
partially atop a disputed easement.
Herreras also filled us in on the crazy time that Maricopa County
Sheriff Joe Arpaio had at a First Amendment Forum at Arizona State
University’s Cronkite School of Journalism, which was interrupted by a
crowd of protesters singing a tricked-out version of “Bohemian
Rhapsody.”
Meanwhile, Jim Nintzel posted a Q&A with Republican
congressional candidate Jesse Kelly, in which Kelly expresses surprise
that Gabrielle Giffords would even get involved in the controversy over
the proposed Rosemont Mine. Says Kelly: “Why does a congresswoman care
about what’s going on there when the local politicians and local
officials can handle that?”
Nintzel also examined how Paradise Valley Mayor Vernon Parker and
Tucson attorney John Munger were beating on Gov. Jan Brewer, whom they
hope to topple in the GOP primary.
Among other tidbits, we also shared the latest photos from Mars taken by the UA’s HiRISE camera aboard the Mars Reconnaissance
Orbiter.
Facebook fans: 1,054
Twitter followers: 1,794
This article appears in Dec 10-16, 2009.
