Ever wonder where you came from? If your mom isn't around to give you the answer, we've got it right here.
The folks at the UA's Human Origins Genotyping Laboratory are in the process of mapping where in the world we all came from. The short answer comes in the form of a genetic family tree of hundreds of thousands of people already in the lab's database. The long answer is ACAAGATGCCATTGTCCCCCGGC ... (You get the idea.)
You can see DNA robots in action in this week's featured video. These robots may not seem as cool as the ones in Star Wars, but they are capable of processing the DNA of all the people you have ever known, or will ever know, within a few hours.
A cheek swab is all it takes to have your DNA entered into their system. (But, please, don't send in an envelope with a Q-tip inside. They have a special kit for that.)
In addition to tracing human-migration patterns, the lab has been using their technology to help with the DNA Shoah Project, which aims to reconnect families victimized by the Holocaust.
As with DNA, you'll need plenty of context to understand what's going on in our next video.
If you live in the northwest area of town, or if you're a glutton for news, you've probably heard of the Saguaro Ranch development.
The 1,035-acre luxury project in the Tortolita Mountains went into bankruptcy in February, all the while drawing complaints from some people living nearby.
Area resident Tracy Chamberlain recently filmed Marana Town Manager Gilbert Davidson arriving at McClintock's with his wife. Neighbors claim the reservations-only restaurant in Saguaro Ranch was partially built on a public easement. And it happens that the Davidsons' evening at the restaurant occurred two days after the arrest of Saguaro Ranch neighbor Steve Blomquist at McClintock's. What happens in that video? Watch to find out.
As reported on The Range, our breaking-news blog, things have gotten to the point where Saguaro Ranch neighbors have filed a federal lawsuit against the town of Marana and several of its leaders.
As we all know, once matters get to federal court, they get harder to untangle than the human genome.
BEST OF WWW
One of the great things about the Internet is you can easily see details that weren't included in a news story, for whatever reason. This week at TucsonWeekly.com, you'll find these extra details on Leo W. Banks' story about the various border studies that were apparently covered up: We've got the studies themselves available for download.
COMMENT OF THE WEEK
"This review is uninformed. ... I find that you are criticizing the actors/actresses for following the character roles that they were hired to play. On top of that, you are telling us your opinion of which actor is the hottest? Please give us a review on cinematography and how well the movie follows the book. Please do your research next time."
—Melissa Benton, via Facebook, in reaction to Bob Grimm's review of The Twilight Saga: New Moon ("Abs vs. Eyebrows," Nov. 26).
THE WEEK ON THE RANGE
Mari Herreras filled us in on the latest news in the battle between neighbors of the exclusive Saguaro Ranch development and the town of Marana, which included the arrest of one of the neighbors as he drank a beer at McClintock's, the reservation-only restaurant which sits partially atop a disputed easement.
Herreras also filled us in on the crazy time that Maricopa County Sheriff Joe Arpaio had at a First Amendment Forum at Arizona State University's Cronkite School of Journalism, which was interrupted by a crowd of protesters singing a tricked-out version of "Bohemian Rhapsody."
Meanwhile, Jim Nintzel posted a Q&A with Republican congressional candidate Jesse Kelly, in which Kelly expresses surprise that Gabrielle Giffords would even get involved in the controversy over the proposed Rosemont Mine. Says Kelly: "Why does a congresswoman care about what's going on there when the local politicians and local officials can handle that?"
Nintzel also examined how Paradise Valley Mayor Vernon Parker and Tucson attorney John Munger were beating on Gov. Jan Brewer, whom they hope to topple in the GOP primary.
Among other tidbits, we also shared the latest photos from Mars taken by the UA's HiRISE camera aboard the Mars Reconnaissance Orbiter.
Facebook fans: 1,054
Twitter followers: 1,794
